View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1492_low_72 (Length: 209)

Name: NF1492_low_72
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1492_low_72
NF1492_low_72
[»] chr1 (1 HSPs)
chr1 (56-181)||(44097399-44097524)


Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 56 - 181
Target Start/End: Complemental strand, 44097524 - 44097399
Alignment:
Q  56 aaggttgaaagagtacagttacataattggatggtttttataaattagtttctaaggtatggaaagaaagaagggagccaggtttgtagatttagctaga 155  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  44097524 aaggttgaaagagtacagttacataattggatggtttttataaatttgtttctaaggtatggaaagaaagaagggacccaggtttgtagatttagctaga 44097425  T
Q  156 aagatgaggtatttaattgtgggatt 181  Q
    ||||||||||||||||||||||||||    
T  44097424 aagatgaggtatttaattgtgggatt 44097399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University