View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1492_low_66 (Length: 236)

Name: NF1492_low_66
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1492_low_66
NF1492_low_66
[»] chr5 (1 HSPs)
chr5 (1-220)||(43410216-43410432)


Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 43410216 - 43410432
Alignment:
Q  1 agattggctctttctatgccagcttcccagagttgagcactgcaactgctaatggtggtgatggtaatgataacaacaacaacaatagcttctataataa 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||   |||||||||||||||||    
T  43410216 agattggctctttctatgccagcttcccagagttgagcaatgcaactgctaatggtggtgatggtaatgataacagcaac---aatagcttctataataa 43410312  T
Q  101 taaccatggagatggaatagttactagtttgaaatccccaccctctgcttgcagtcagacccatgcaggaaacaaattacctatgactactactactgcc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43410313 taaccatggagatggaatagttactagtttgaaatccccaccctctgcttgcagtcagacccatgcaggaaacaaattacctatgactactactactgcc 43410412  T
Q  201 attaaccatcatcatgttgt 220  Q
    ||||||||||||||||||||    
T  43410413 attaaccatcatcatgttgt 43410432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University