View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1492_low_64 (Length: 238)

Name: NF1492_low_64
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1492_low_64
NF1492_low_64
[»] chr8 (1 HSPs)
chr8 (18-195)||(9298325-9298502)


Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 9298502 - 9298325
Alignment:
Q  18 ctctcttcctcaaaaggttttcatcattacatccttttcgtgtttctttctctgattttgttatgatgatgtttttgttgtcaggtttgtaacacctttt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  9298502 ctctcttcctcaaaaggttttcatcattacatccttttcgtgtttctttctctgattttgttatgatgatgtttttgttgtcaggtttggaacacctttt 9298403  T
Q  118 tctttgttgttcatcattagatactagatcttctcacaattatgtttttttctttcggatctgtcggtttctgccatg 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9298402 tctttgttgttcatcattagatactagatcttctcacaattatgtttttttctttcggatctgtcggtttctgccatg 9298325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University