View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1492_high_56 (Length: 245)

Name: NF1492_high_56
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1492_high_56
NF1492_high_56
[»] chr8 (2 HSPs)
chr8 (88-227)||(10055725-10055864)
chr8 (17-64)||(10056869-10056916)


Alignment Details
Target: chr8 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 88 - 227
Target Start/End: Complemental strand, 10055864 - 10055725
Alignment:
Q  88 caatgacgtagaatttgacactgag--tgttagtttgttaagcaattgtccctggatcagnnnnnnnaatgaagtgccaacgttgcactcgttaaatttg 185  Q
    |||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||    
T  10055864 caatgacgtagaatttgacactgagagtgttagtttgttaagcaattgtccctggatcagtttttttaatgaagtgccaacgttgcactcgttaaatttg 10055765  T
Q  186 gtttacgatatgtacgaatggggtacttagttagctttatct 227  Q
    |||||||||||||||||||  |||||||||||||||||||||    
T  10055764 gtttacgatatgtacgaat--ggtacttagttagctttatct 10055725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 17 - 64
Target Start/End: Complemental strand, 10056916 - 10056869
Alignment:
Q  17 tgtaagattgaaaaagaaacattaatgtttcattgctatcttaaaatg 64  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  10056916 tgtaagattgaaaaagaaacattaatgtttcattgctatcttaaaatg 10056869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University