View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14928_low_12 (Length: 294)

Name: NF14928_low_12
Description: NF14928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14928_low_12
NF14928_low_12
[»] chr7 (1 HSPs)
chr7 (76-277)||(46895912-46896113)


Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 76 - 277
Target Start/End: Complemental strand, 46896113 - 46895912
Alignment:
Q  76 cccatacatttacctaataaaaacaaactactttgttaatgtactcagatttcatataacaaaataaaagcgtgtaagattaatagtagcaaaagtttat 175  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  46896113 cccatacatttacctaataaaaacaaactactttgttaatgtactcagatttcatataacaaaataaaagcttgtaagattaatagtagcaaaagtttat 46896014  T
Q  176 ttaccatcatagaattaaaaatataagttcaaaatattgctgttgttactactataaatgaacattaacactttcatatttgtttccatgaaagcttgca 275  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46896013 ttaccatcatagaattaaaaatataagttcaaaatattgctgttgttactactataaatgaacattaacactttcatatttgtttccatgaaagcttgca 46895914  T
Q  276 cg 277  Q
    ||    
T  46895913 cg 46895912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University