View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14924_low_46 (Length: 201)

Name: NF14924_low_46
Description: NF14924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14924_low_46
NF14924_low_46
[»] chr7 (1 HSPs)
chr7 (2-159)||(49082661-49082812)


Alignment Details
Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 2 - 159
Target Start/End: Complemental strand, 49082812 - 49082661
Alignment:
Q  2 gttggattggaatataagtaagtatattgacattgacatacagtagtatttcttctccacacatgctgccacaggttcctaagctcattcctgcgaactg 101  Q
    ||||||||||||||||| |||||||||||||||      |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  49082812 gttggattggaatataaataagtatattgacat------acagtagtatttcttctccacacatgctgccacaagttcctaagctcattcctgcgaactg 49082719  T
Q  102 gtttaatgagaaaatcgacagccccgttgagcatgaatttgaatacagtgctaactga 159  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49082718 gtttaatgagaaaatcgacagccccgttgagcatgaatttgaatacagtgctaactga 49082661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University