View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14924_low_21 (Length: 310)

Name: NF14924_low_21
Description: NF14924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14924_low_21
NF14924_low_21
[»] chr7 (1 HSPs)
chr7 (71-294)||(11464752-11464975)
[»] chr3 (1 HSPs)
chr3 (103-167)||(34325455-34325519)


Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 71 - 294
Target Start/End: Complemental strand, 11464975 - 11464752
Alignment:
Q  71 ttgtttatgtttatgtgatgggtggggtaacatcatcaatggcatcaaaatttgcattctttccaccaaacccaccatcatacaagctaatcaaagatga 170  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  11464975 ttgtttatgtttatgtgatgggtggggtaacatcatcaatggcatcaaaatttgcattctttccaccaaacccaccatcatacaaactaatcaaagatga 11464876  T
Q  171 tttaacaggtctacttctgttaacaccatttcctcaccgtgaaaacgttgaaattatgaaactttcgacacgtcgaggaacggagattgtggctgtttat 270  Q
    |||||||||||| |||||  ||||||| | ||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||    
T  11464875 tttaacaggtcttcttctactaacaccttatcctcaccgtgaaaacgttgagattatgaaactttcgacgcgtcgaggaacggagattgtggctgtttat 11464776  T
Q  271 gttcgtcatccaatggctacttca 294  Q
    ||||||||||||||||||||||||    
T  11464775 gttcgtcatccaatggctacttca 11464752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 103 - 167
Target Start/End: Complemental strand, 34325519 - 34325455
Alignment:
Q  103 tcatcaatggcatcaaaatttgcattctttccaccaaacccaccatcatacaagctaatcaaaga 167  Q
    |||||||||||| | ||||| |||||||||||||||||||||||||||||||| || ||||||||    
T  34325519 tcatcaatggcagcgaaattagcattctttccaccaaacccaccatcatacaaactcatcaaaga 34325455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University