View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14923_low_7 (Length: 282)

Name: NF14923_low_7
Description: NF14923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14923_low_7
NF14923_low_7
[»] chr2 (1 HSPs)
chr2 (42-260)||(35189544-35189762)


Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 42 - 260
Target Start/End: Original strand, 35189544 - 35189762
Alignment:
Q  42 atacagaacaatccaactgtctagtaatagtatggttaaaatatttgaagaatgaaagattggcttacctgagagagacgaggttagtgcaaggagctaa 141  Q
    |||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35189544 atacagcacaatccaactgtctagtaattgtatggttaaaatatttgaagaatgaaagattggcttacctgagagagacgaggttagtgcaaggagctaa 35189643  T
Q  142 aatggtgagaaagatagagaaaacatattcacggtcagtgtaaaacaaagtgatatccagttcatgtagacaagacccagtggcgctacgaatccacgag 241  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||    
T  35189644 aatggtgagaaagatagagaaaacatattcacggtcagtgtaaaacaaagtgatatccagttcctgtagacaagagccagtggcgctacgaatccacgag 35189743  T
Q  242 tcaatagagttgtagaaga 260  Q
    |||||||||||| ||||||    
T  35189744 tcaatagagttggagaaga 35189762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University