View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14920_low_17 (Length: 232)

Name: NF14920_low_17
Description: NF14920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14920_low_17
NF14920_low_17
[»] chr3 (1 HSPs)
chr3 (66-217)||(50371533-50371684)


Alignment Details
Target: chr3 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 66 - 217
Target Start/End: Complemental strand, 50371684 - 50371533
Alignment:
Q  66 gtgtaatggaaacagtgagatttgaactttggattttcgatcatgcatattatattactcaaacccctcacaactagttttctgaatttatgatctaact 165  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50371684 gtgtaatggaaacagtgtgatttgaactttggattttcgatcatgcatattatattactcaaacccctcacaactagttttctgaatttatgatctaact 50371585  T
Q  166 acacagtttcattcatttattcttattttctgtattgattttggtatatact 217  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50371584 gcacagtttcattcatttattcttattttctgtattgattttggtatatact 50371533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University