View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14920_high_23 (Length: 205)

Name: NF14920_high_23
Description: NF14920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14920_high_23
NF14920_high_23
[»] chr3 (1 HSPs)
chr3 (18-191)||(40216260-40216433)


Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 40216260 - 40216433
Alignment:
Q  18 agaagtggggttttaccattttgataattgggttggttgagattttaaggaattgatttttaggtgggttttgatggatattgatgggaatacacacaag 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40216260 agaagtggggttttaccattttgataattgggttggttgagattttaaggaattgatttttaggtgggttttgatggatattgatgggaatacacacaag 40216359  T
Q  118 agctacaaaatattgaaagagagattgattaatcagaggattaagggactttgttgaaagcaaagaggaggagc 191  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||    
T  40216360 agctacaaaatattgaaagagagattgattaatcagaggataaagggactttgttgaaagcaaagagtaggagc 40216433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University