View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14919_high_27 (Length: 281)

Name: NF14919_high_27
Description: NF14919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14919_high_27
NF14919_high_27
[»] chr2 (1 HSPs)
chr2 (100-214)||(11316339-11316455)


Alignment Details
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 100 - 214
Target Start/End: Original strand, 11316339 - 11316455
Alignment:
Q  100 tctatatgttttttaaattcatgccaaatacgattaaaagaggatttggtgtgcca---nnnnnnnngttcttcatccttaaatctgcccttctttgtca 196  Q
    ||||||||||||||||||||||||||||||| |||||||||| || | | ||||||           ||||||||||||||||||||  |||||||||||    
T  11316339 tctatatgttttttaaattcatgccaaatacaattaaaagagaatctcgagtgccattttcttttttgttcttcatccttaaatctg-tcttctttgtca 11316437  T
Q  197 tcctctcattcttcttca 214  Q
    ||||| ||||||||||||    
T  11316438 tcctcccattcttcttca 11316455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University