View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14918_high_6 (Length: 341)

Name: NF14918_high_6
Description: NF14918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14918_high_6
NF14918_high_6
[»] chr2 (1 HSPs)
chr2 (1-323)||(5333864-5334186)


Alignment Details
Target: chr2 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 323
Target Start/End: Original strand, 5333864 - 5334186
Alignment:
Q  1 tcaatcgccggccgtactgcaaaatcgaatttctccggcggtggtgaagtttttgaatgaaccaaagtttcatctaaatcaagaaaaatggttttccgat 100  Q
    |||||| ||||||| ||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5333864 tcaatcaccggccggacaacaaaatcgaatttctccggcggtggtgaagtttttgaatgaaccaaagtttcatctaaatcaagaaaaatggttttccgat 5333963  T
Q  101 ttgatattgaaggtggaagaagagaattttcgacgctatcttcgaaaagcagggttttgcaaacggtgtcttgttgttgaaagttgaaatgtgctgattt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5333964 ttgatattgaaggtggaagaagagaattttcgacgctatcttcgaaaagcagggttttgcaaacggtgtcttgttgttgaaagttgaaatgtgctgattt 5334063  T
Q  201 cttgaggattttgtagctgtttcgtttccgatttgaagaactgagacgagtgagtcccagtttggtgagaagctttgaaatgcggcggtggatggaagaa 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5334064 cttgaggattttgtagctgtttcgtttccgatttgaagaactgagacgagtgagtcccagtttggtgagaagctttgaaatgcggcggtggatggaagaa 5334163  T
Q  301 agaacggcggaggaagctgcgac 323  Q
    |||||||||||||||||||||||    
T  5334164 agaacggcggaggaagctgcgac 5334186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University