View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14917_low_34 (Length: 239)

Name: NF14917_low_34
Description: NF14917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14917_low_34
NF14917_low_34
[»] chr4 (1 HSPs)
chr4 (16-224)||(27715214-27715415)


Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 16 - 224
Target Start/End: Original strand, 27715214 - 27715415
Alignment:
Q  16 atgcaaggactgatgtaatactaatatagtagttatgcttttctttatgtctcaaaataagttgctgaannnnnnnctcttaactttcagttttagatga 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||       ||||||||||||||||||||||||    
T  27715214 atgcaaggactgatgtaatactaatatagtagttatgcttttctttatgtctcaaaccaagttgctgaatttttttctcttaactttcagttttagatga 27715313  T
Q  116 agcaaatagaacactattcgaatttcgagcctatcatgaaaaaagtgtatgaattaataatannnnnnnnnatttgtataatattcaaatcaaaaggacc 215  Q
    ||||||||||||||||       |||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||    
T  27715314 agcaaatagaacacta-------ttcgagcctatcatgaaaaaagtgtatgaattaataatatttttttttatttgtataatattcaaatcaaaaggacc 27715406  T
Q  216 tgtaaaatt 224  Q
    |||||||||    
T  27715407 tgtaaaatt 27715415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University