View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14916_low_34 (Length: 225)

Name: NF14916_low_34
Description: NF14916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14916_low_34
NF14916_low_34
[»] chr2 (1 HSPs)
chr2 (18-209)||(25989745-25989938)


Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 25989745 - 25989938
Alignment:
Q  18 agagagctagagagaaaatgaattattgaatgagtttaggaaaattaaggatattcaaatgtaagtat-gattaaagtattgcaaccgatcaacttgaac 116  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  25989745 agagagctagagagaaaatgaattgttgaatgagtttaggaaaattaaggatattcaaatgtaagtattgattaaagtattgcaaccgatcaacttgaac 25989844  T
Q  117 ttaaaattttgtgagtgacctttcgaacacagcacaagggaacgataaaagcatatcaaagaaaacgttaaggcaaag-aacaatcaaacaaaa 209  Q
     |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||    
T  25989845 ataaaatttggtgagtgacctttcgaacacagcacaagggaacgataaaagcatatcaaagaaaacgttgaggcaaagaaacaatcaaacaaaa 25989938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University