View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14912_low_28 (Length: 291)

Name: NF14912_low_28
Description: NF14912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14912_low_28
NF14912_low_28
[»] chr1 (2 HSPs)
chr1 (157-268)||(7158984-7159096)
chr1 (235-265)||(7158475-7158505)


Alignment Details
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 157 - 268
Target Start/End: Original strand, 7158984 - 7159096
Alignment:
Q  157 cgatttttattattttctaaattaatgtaccaatttctccaaaatgtagggtttatctct-aaaaaattggtgtatttggtctagtaatccatttattgt 255  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  7158984 cgatctttattattttctaaattaatgtaccaatttctccaaaatgtagggtttatctctaaaaaaattggtgtatttggtctagtaatccatttattgt 7159083  T
Q  256 agggtttatctct 268  Q
    |||||||||||||    
T  7159084 agggtttatctct 7159096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 265
Target Start/End: Original strand, 7158475 - 7158505
Alignment:
Q  235 gtctagtaatccatttattgtagggtttatc 265  Q
    |||||||||||||||||||||||||||||||    
T  7158475 gtctagtaatccatttattgtagggtttatc 7158505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University