View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1490_low_25 (Length: 312)

Name: NF1490_low_25
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1490_low_25
NF1490_low_25
[»] chr2 (2 HSPs)
chr2 (86-170)||(1810215-1810299)
chr2 (20-72)||(1810292-1810344)


Alignment Details
Target: chr2 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 86 - 170
Target Start/End: Complemental strand, 1810299 - 1810215
Alignment:
Q  86 gccggtgggggtcattggtttgggcgggaagagaaatgaatcactttctatctatggcgcggtttctctctactcaactcataat 170  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  1810299 gccggtgggggtcattggtttgggcgggaagagaaattaatcactttctatctatggcgcggtttctctctactcaactcataat 1810215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 20 - 72
Target Start/End: Complemental strand, 1810344 - 1810292
Alignment:
Q  20 aaggaggaaagtagccatcagattcttccagtatccttcatcatcgccggtgg 72  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1810344 aaggaggaaagtagccatcagattcttccagtatccttcatcatcgccggtgg 1810292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University