View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1490_high_43 (Length: 247)

Name: NF1490_high_43
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1490_high_43
NF1490_high_43
[»] chr5 (2 HSPs)
chr5 (31-88)||(15935689-15935746)
chr5 (117-190)||(15935587-15935660)


Alignment Details
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 31 - 88
Target Start/End: Complemental strand, 15935746 - 15935689
Alignment:
Q  31 gttcgctcctttgggagccgttctatctttccttttccctcgtacaaatcgaattact 88  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15935746 gttcgctcctttgggagccgttctatctttccttttccctcgtacaaatcgaattact 15935689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 117 - 190
Target Start/End: Complemental strand, 15935660 - 15935587
Alignment:
Q  117 aaatactcgagcccgttgctttgaaggattttcttatttacagtttgtactctttctctttcttcttcatccca 190  Q
    ||||||||||||| |||||||||||||||||| |||||||||||||||||| || ||||||||||| |||||||    
T  15935660 aaatactcgagccagttgctttgaaggattttattatttacagtttgtacttttactctttcttctgcatccca 15935587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University