View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14906_high_10 (Length: 249)

Name: NF14906_high_10
Description: NF14906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14906_high_10
NF14906_high_10
[»] chr5 (2 HSPs)
chr5 (1-109)||(38448758-38448866)
chr5 (124-223)||(38448574-38448673)


Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 38448866 - 38448758
Alignment:
Q  1 cattcttaaatcagaagcttcgaaatgactttggaatgtacgctaatagaaaccattttgatgacatggaaataaaggatgattaggaatcaataataat 100  Q
    |||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38448866 cattcttaaatcagaagcttggaaatgactttggaatttacgctaatagaaaccattttgatgacatggaaataaaggatgattaggaatcaataataat 38448767  T
Q  101 gagttccaa 109  Q
    |||||||||    
T  38448766 gagttccaa 38448758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 124 - 223
Target Start/End: Complemental strand, 38448673 - 38448574
Alignment:
Q  124 gccatgatttttccttctcagcagccacaatagtatgaccataaagcataataattcacatttaataagcaataaggtgaaggaaaaagaatactgacat 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38448673 gccatgatttttccttctcagcagccacaatagtatgaccataaagcataataattcacatttaataagcaataaggtgaaggaaaaagaatactgacat 38448574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University