View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14904_low_29 (Length: 201)

Name: NF14904_low_29
Description: NF14904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14904_low_29
NF14904_low_29
[»] chr6 (2 HSPs)
chr6 (111-183)||(8206477-8206549)
chr6 (14-59)||(8206601-8206646)


Alignment Details
Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 111 - 183
Target Start/End: Complemental strand, 8206549 - 8206477
Alignment:
Q  111 ctcataagcacatcaccaagtctttaaaaatggaaaattgtttagccaccggatattttaacaggctaacaaa 183  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8206549 ctcataagcacatcatcaagtctttaaaaatggaaaattgtttagccaccggatattttaacaggctaacaaa 8206477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 14 - 59
Target Start/End: Complemental strand, 8206646 - 8206601
Alignment:
Q  14 cagagacccaatttagaatgaacctttgttcaacgcacaccaagtc 59  Q
    |||| ||||||||||||||||| |||||||||||||||||||||||    
T  8206646 cagaaacccaatttagaatgaatctttgttcaacgcacaccaagtc 8206601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University