View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14904_low_25 (Length: 229)

Name: NF14904_low_25
Description: NF14904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14904_low_25
NF14904_low_25
[»] chr7 (1 HSPs)
chr7 (10-209)||(45305962-45306161)


Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 10 - 209
Target Start/End: Complemental strand, 45306161 - 45305962
Alignment:
Q  10 agcaaagggagccaaaatctcaaaacaaatnnnnnnngatctcaaaagtttttgttttcgagttgggttttggaggattttagagttgaagactttggaa 109  Q
    ||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45306161 agcaaagggagccaaaatctcaaaacaaataaaaaaagatctcaaaagtttttgttttcgagttgggttttggaggattttagagttgaagactttggaa 45306062  T
Q  110 agcaaagtctatatttgatatatttnnnnnnnntaaaattaaagagcaacaatgcaattctaaacaacatcaaaatctttaaaatgactctataaatgaa 209  Q
    || ||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45306061 agtaaagtctatatttgatatatttaaaaaaaataaaattaaagagcaacaatgcaattctaaacaacatcaaaatctttaaaatgactctataaatgaa 45305962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University