View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14903_low_13 (Length: 253)

Name: NF14903_low_13
Description: NF14903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14903_low_13
NF14903_low_13
[»] chr5 (1 HSPs)
chr5 (151-253)||(39541469-39541571)


Alignment Details
Target: chr5 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 151 - 253
Target Start/End: Original strand, 39541469 - 39541571
Alignment:
Q  151 gatgatgatgtgattttctcttcaatgatttgcaagcatttgtactctacatgcatgcatgtttatgctttcttcttttgattattctccaaggctatgt 250  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||||    
T  39541469 gatgatgatgggattttctcttcaatgatttgcaagcatttgtactctacatgcatgcatgtttatgctttcttctgttgatcatgctccaaggctatgt 39541568  T
Q  251 gat 253  Q
    |||    
T  39541569 gat 39541571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University