View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14902_high_2 (Length: 357)

Name: NF14902_high_2
Description: NF14902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14902_high_2
NF14902_high_2
[»] chr8 (1 HSPs)
chr8 (251-304)||(22552201-22552254)
[»] chr4 (1 HSPs)
chr4 (102-130)||(33962309-33962337)


Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 251 - 304
Target Start/End: Original strand, 22552201 - 22552254
Alignment:
Q  251 tccccttccaaccaccgcaacaaacgctgcagtcgcagtcgtaaccccaacgcc 304  Q
    ||||||||||||||||||||||||||  |  |||| ||||||||||||||||||    
T  22552201 tccccttccaaccaccgcaacaaacgtcgtcgtcgtagtcgtaaccccaacgcc 22552254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 102 - 130
Target Start/End: Original strand, 33962309 - 33962337
Alignment:
Q  102 aacaaatgctgcaatctcccccatttttt 130  Q
    |||||||||||||||||||||||||||||    
T  33962309 aacaaatgctgcaatctcccccatttttt 33962337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University