View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14894_high_3 (Length: 427)

Name: NF14894_high_3
Description: NF14894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14894_high_3
NF14894_high_3
[»] chr8 (1 HSPs)
chr8 (31-152)||(5665282-5665403)


Alignment Details
Target: chr8 (Bit Score: 86; Significance: 6e-41; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 31 - 152
Target Start/End: Original strand, 5665282 - 5665403
Alignment:
Q  31 ttgatgattttggtcttgagcttagacgaattgtagtgtttaatggtgtttcctataatgaacttgaagtggttgttgagaagaaggctggctggctgtg 130  Q
    |||| |||||||||||||| ||||||||||||||||| ||||  ||||||| |||||||||||||||||||||||||||||||||| ||| ||||| |||    
T  5665282 ttgacgattttggtcttgaacttagacgaattgtagtatttatcggtgttttctataatgaacttgaagtggttgttgagaagaagactgactggccgtg 5665381  T
Q  131 ttttactcatggatggcgtgaa 152  Q
    ||||||||||||||||||||||    
T  5665382 ttttactcatggatggcgtgaa 5665403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University