View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14890_high_2 (Length: 220)

Name: NF14890_high_2
Description: NF14890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14890_high_2
NF14890_high_2
[»] chr5 (2 HSPs)
chr5 (130-205)||(28053524-28053599)
chr5 (18-54)||(28053675-28053711)


Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 130 - 205
Target Start/End: Complemental strand, 28053599 - 28053524
Alignment:
Q  130 tacgctaaggagtgtaaagaaagctatgaactacaaacagcgttggcgaagaggctttctttcttatcaacctttg 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28053599 tacgctaaggagtgtaaagaaagctatgaactacaaacagcgttggcgaagaggctttctttcttatcaacctttg 28053524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 18 - 54
Target Start/End: Complemental strand, 28053711 - 28053675
Alignment:
Q  18 aaaagaagatacgtcgtcgtttcgagtttctactaat 54  Q
    |||||||||||||||||||||||||||||||||||||    
T  28053711 aaaagaagatacgtcgtcgtttcgagtttctactaat 28053675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University