View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14888_high_5 (Length: 207)

Name: NF14888_high_5
Description: NF14888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14888_high_5
NF14888_high_5
[»] chr3 (1 HSPs)
chr3 (11-189)||(25296111-25296289)


Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 11 - 189
Target Start/End: Original strand, 25296111 - 25296289
Alignment:
Q  11 atcatcatcatcttcttctgcattgtggccaactcaggcccatgatcttccccaccacggtgcattgccaaatgtggcaaatgcatcccatgcatagcaa 110  Q
    |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25296111 atcatcttcttcttcttctgcattgtggccaactcaggcccatgatcttccccaccacggtgcattgccaaatgtggcaaatgcatcccatgcatagcaa 25296210  T
Q  111 tggtggggaatgttggaatttcagccgggaatttccctcaagcctggaggtgcttttgcggagggaaattctacaatcc 189  Q
    |||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  25296211 tggtggggaatgttggaatttcagtcgggtatttccctcaagcctggaggtgcttttgcggagggaaattctacaatcc 25296289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University