View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14882_low_21 (Length: 206)

Name: NF14882_low_21
Description: NF14882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14882_low_21
NF14882_low_21
[»] chr8 (1 HSPs)
chr8 (15-188)||(28587254-28587427)


Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 188
Target Start/End: Complemental strand, 28587427 - 28587254
Alignment:
Q  15 gagatgaaagatgtaggaaagcaagaatttgttgcttcactgcgaaggtttgaatgagctagcctattatattatcagcactacaattcaatgcctcacc 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  28587427 gagatgaaagatgtaggaaagcaagaatttgttgcttcactgcgaaggtttgaatgagctagcctattatattatcagcactataattcaatgcctcacc 28587328  T
Q  115 taaaattgtaattcttctgcttgcaggacaagcactggtttttcgaggggagcttccaagtacaggggtgttac 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28587327 taaaattgtaattcttctgcttgcaggacaagcactggtttttcgaggggagcttccaagtacaggggtgttac 28587254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University