View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14881_low_10 (Length: 227)

Name: NF14881_low_10
Description: NF14881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14881_low_10
NF14881_low_10
[»] chr5 (1 HSPs)
chr5 (20-218)||(40654240-40654438)


Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 218
Target Start/End: Complemental strand, 40654438 - 40654240
Alignment:
Q  20 ttttgcacttgttctaattaacatgcctaatttttcattgtgatttggaacgagtctattctatgagatcttttggtggattgtcaatccaatcattcaa 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  40654438 ttttgcacttgttctaattaacatgcctaatttttcattgtgatttggaatgagtctattctatgagatcttttggtggattgtcaatccaatcattcaa 40654339  T
Q  120 ataaaaagagaaacaaaaatggagtgctgaaatttcagcaatcatttgcttcttcatctttcacctcctccccctcctgcttttacagaataatctacc 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||    
T  40654338 ataaaaagagaaacaaaaatggagtgctgaaatttcagcaatcatttgcttcttcatctttcacctcctccccctgctgcttttacagattaatttacc 40654240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University