View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14878_high_13 (Length: 268)

Name: NF14878_high_13
Description: NF14878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14878_high_13
NF14878_high_13
[»] chr4 (1 HSPs)
chr4 (108-268)||(1332759-1332930)


Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 108 - 268
Target Start/End: Original strand, 1332759 - 1332930
Alignment:
Q  108 aagagtttagtggccaaactcacacacattagaattagtttatgatagt-----------taattacaataagtgtggggtgatctttatatatagatcc 196  Q
    |||||||||||||| ||||||||||||||||||||||||||||| ||||           ||||||||||||||||||||||||||||||||||||||||    
T  1332759 aagagtttagtggcgaaactcacacacattagaattagtttatgttagttgcaagttagttaattacaataagtgtggggtgatctttatatatagatcc 1332858  T
Q  197 aaaaataactagaataactaactagaaactaatttcactatccctataagcttaactcaattggtagggaca 268  Q
    |||||||||||||| | |||||||||||||||||| |||||||||||||||||| |||||||||||||||||    
T  1332859 aaaaataactagaagacctaactagaaactaatttaactatccctataagcttagctcaattggtagggaca 1332930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University