View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14877_high_17 (Length: 219)

Name: NF14877_high_17
Description: NF14877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14877_high_17
NF14877_high_17
[»] chr3 (1 HSPs)
chr3 (20-205)||(32266438-32266623)


Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 32266438 - 32266623
Alignment:
Q  20 cacagttactagttttgccgttgtttctcaagctttgacagaactcaaccttatgagtacggagctagggcaaattgctttatcttcagcaatgatcact 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32266438 cacagttactagttttgccgttgtttctcaagctttgacagaactcaaccttatgagtacggagctagggcaaattgctttatcttcagcaatgatcact 32266537  T
Q  120 gaaatgatgcaatgggttacgataacactacaaatacaagtcaaaactatgaagtttaaaaatatcttttttgcgttcattgcctt 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32266538 gaaatgatgcaatgggttacgataacactacaaatacaagtcaaaactatgaagtttaaaaatatcttttttgcgttcattgcctt 32266623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University