View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14875_low_33 (Length: 202)

Name: NF14875_low_33
Description: NF14875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14875_low_33
NF14875_low_33
[»] chr8 (2 HSPs)
chr8 (115-188)||(38051886-38051959)
chr8 (18-49)||(38052025-38052056)


Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 115 - 188
Target Start/End: Complemental strand, 38051959 - 38051886
Alignment:
Q  115 cccttgagcttctgtagtaggattcggtccttccacatgcgcttcttcagctcgtcataatcgatttcttcttc 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38051959 cccttgagcttctgtagtaggattcggtccttccacatgcgcttcttcagctcgtcataatcgatttcttcttc 38051886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 18 - 49
Target Start/End: Complemental strand, 38052056 - 38052025
Alignment:
Q  18 gtatttgagaattgaatcttgtgctcttgaca 49  Q
    ||||||||||||||||||||||||||||||||    
T  38052056 gtatttgagaattgaatcttgtgctcttgaca 38052025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University