View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14872_low_4 (Length: 258)

Name: NF14872_low_4
Description: NF14872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14872_low_4
NF14872_low_4
[»] chr3 (2 HSPs)
chr3 (21-120)||(38826122-38826221)
chr3 (116-230)||(38820964-38821078)


Alignment Details
Target: chr3 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 21 - 120
Target Start/End: Complemental strand, 38826221 - 38826122
Alignment:
Q  21 ttggtatgtctacttgttgcactagatcaatgaaagcttcatccgttagttttttgttaactttttgatcttattttgtagcgttgaccatgctcattgc 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  38826221 ttggtatgtctacttgttgcactagatcaatgaaagcttcatccgttagttttttgttaactttttgatcttattttgtagcgttgaccatgttcattgc 38826122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 116 - 230
Target Start/End: Complemental strand, 38821078 - 38820964
Alignment:
Q  116 attgccattagtatcccattctttggttctcttcttggattcctcggtgggtttgccttagccccaacaagttacttcgtaagcaaaccannnnnnncat 215  Q
    |||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||       |||    
T  38821078 attgccattagtgtcccattctttggttctcttcttggattcctcggagggtttgccttagccccaacaagttacttcgtaagcaaaccatttttttcat 38820979  T
Q  216 actatcttattcaat 230  Q
    |||||||||||||||    
T  38820978 actatcttattcaat 38820964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University