View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14869_low_24 (Length: 236)

Name: NF14869_low_24
Description: NF14869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14869_low_24
NF14869_low_24
[»] chr4 (1 HSPs)
chr4 (1-217)||(42022678-42022898)


Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 42022678 - 42022898
Alignment:
Q  1 caaataatgatataaactatcacaaaagtagctttaa------ccgcgagattgtaaaggatatagacccaaataatgattcaaactcaacattatgagt 94  Q
    |||||||||||||||||||||||||||||||||||||      ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42022678 caaataatgatataaactatcacaaaagtagctttaattataaccgggagattgtaaaggatatagacccaaataatgattcaaactcaacattatgagt 42022777  T
Q  95 ggtaaatctacttttttggcaagatacatgtccatgatgcatatgcaaagtggcaagttggatgcattaacaaagttgcaagatgaatgagatgcaaacg 194  Q
    | ||||||||||||||||||||||||||||||||||||||  ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||    
T  42022778 gataaatctacttttttggcaagatacatgtccatgatgc--atgcaaagtggaaagttggatgcattaacaaagttgcaagaagaatgagatgcaaacg 42022875  T
Q  195 acattttgcacacttgtgtatag 217  Q
    |||||||||||||||||||||||    
T  42022876 acattttgcacacttgtgtatag 42022898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University