View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14861_low_22 (Length: 302)

Name: NF14861_low_22
Description: NF14861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14861_low_22
NF14861_low_22
[»] chr1 (1 HSPs)
chr1 (18-299)||(52784714-52784995)


Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 18 - 299
Target Start/End: Complemental strand, 52784995 - 52784714
Alignment:
Q  18 agttccagatccaatcatcgaagaggccatgaattatgcctgttggtcaggagcagactgcagttcgattcagccgaacgggccttgctttcagcccgac 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52784995 agttccagatccaatcatcgaagaggccatgaattatgcctgttggtcaggagcagactgcagttcgattcagccgaacgggccttgctttcagcccgac 52784896  T
Q  118 agtgtatttgcacatgcttcctatgccttcaatagttactggcaaaggacgaaagcttctggtggcacttgcgagtttggagggacagccgtattagttt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52784895 agtgtatttgcacatgcttcctatgccttcaatagttactggcaaaggacgaaagcttctggtggcacttgcgagtttggagggacagccgtattagttt 52784796  T
Q  218 cggttgaccctagtgagtaatttaatttagtaaacttgtttggttcattttatgccaaagtaacaaactcataattgctacc 299  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52784795 cagttgaccctagtgagtaatttaatttagtaaacttgtttggttcattttatgccaaagtaacaaactcataattgctacc 52784714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University