View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14857_low_18 (Length: 239)

Name: NF14857_low_18
Description: NF14857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14857_low_18
NF14857_low_18
[»] chr4 (1 HSPs)
chr4 (187-238)||(24159157-24159208)


Alignment Details
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 187 - 238
Target Start/End: Original strand, 24159157 - 24159208
Alignment:
Q  187 cagacacacacttgccgaatctcacaaaaaatatctaaattccctttctctt 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24159157 cagacacacacttgccgaatctcacaaaaaatatctaaattccctttctctt 24159208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University