View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14855_low_23 (Length: 251)

Name: NF14855_low_23
Description: NF14855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14855_low_23
NF14855_low_23
[»] chr7 (1 HSPs)
chr7 (90-236)||(3616900-3617046)


Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 90 - 236
Target Start/End: Complemental strand, 3617046 - 3616900
Alignment:
Q  90 gttctacactcacaatgacgtgtcatgaaagttgatcttaaaaattattattaatatctgcgtgtcaatatcatatctaatgtttgtaaggtgagtgttt 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  3617046 gttctacactcacaatgacgtgtcatgaaagttgatcttaaaaattattattaatgtctgcgtgtcaatatcatatctaatgtttgtaaggtgagtgttt 3616947  T
Q  190 tatagttcactagatgcttaaaataatgcattgttacctggacaagg 236  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||    
T  3616946 tatagttcactagatgcttaaaataatgcattgttacttggacaagg 3616900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University