View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1484_high_44 (Length: 295)

Name: NF1484_high_44
Description: NF1484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1484_high_44
NF1484_high_44
[»] chr4 (2 HSPs)
chr4 (95-277)||(40820087-40820269)
chr4 (14-52)||(40820312-40820350)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 95 - 277
Target Start/End: Complemental strand, 40820269 - 40820087
Alignment:
Q  95 tatacagatagaaacttctattgctcgaatgaggcttgatcgttgccattacctccaaaaatcaaacatttttgttgccgtttactccagttttgccttc 194  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40820269 tatacagatagaaacttctgttgctcgaatgaggcttgatcgttgccattacctccaaaaatcaaacatttttgttgccgtttactccagttttgccttc 40820170  T
Q  195 ccaccagattcaacttccaccatggaggtgtccttttccaaatgacatgtgtgatgtgtgataatgcagtagagtatgatatt 277  Q
    |||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40820169 ccaccagattcaacctccaccatggaggtgttcttttccaaatgacatgtgtgatgtgtgataatgcagtagagtatgatatt 40820087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 14 - 52
Target Start/End: Complemental strand, 40820350 - 40820312
Alignment:
Q  14 cataggtcattaactcgtttctatatcttaggagttagg 52  Q
    |||||||||||||||||||||||| ||||||||||||||    
T  40820350 cataggtcattaactcgtttctatctcttaggagttagg 40820312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University