View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14847_low_3 (Length: 523)

Name: NF14847_low_3
Description: NF14847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14847_low_3
NF14847_low_3
[»] scaffold1064 (1 HSPs)
scaffold1064 (105-234)||(2575-2704)
[»] chr8 (1 HSPs)
chr8 (124-210)||(26825299-26825385)


Alignment Details
Target: scaffold1064 (Bit Score: 126; Significance: 1e-64; HSPs: 1)
Name: scaffold1064
Description:

Target: scaffold1064; HSP #1
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 105 - 234
Target Start/End: Complemental strand, 2704 - 2575
Alignment:
Q  105 tctcaatggaaaaccatcatgtagtaattgcagagtatattgctgcatactataaagaaactagagttttgattagttaggatcagattcctgacaagat 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  2704 tctcaatggaaaaccatcatgtagtaattgcagagtatattgctgcatactacaaagaaactagagttttgattagttaggatcagattcctgacaagat 2605  T
Q  205 aggtgaacctctgaagccaagaaggatgag 234  Q
    ||||||||||||||||||||||||||||||    
T  2604 aggtgaacctctgaagccaagaaggatgag 2575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 124 - 210
Target Start/End: Complemental strand, 26825385 - 26825299
Alignment:
Q  124 tgtagtaattgcagagtatattgctgcatactataaagaaactagagttttgattagttaggatcagattcctgacaagataggtga 210  Q
    |||||||||||||||||| |||||||||||||| || || ||| |||||   ||||    |||||||||||| ||||||||||||||    
T  26825385 tgtagtaattgcagagtacattgctgcatactacaaggagactggagttcccattaagcgggatcagattccagacaagataggtga 26825299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University