View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14847_low_16 (Length: 266)

Name: NF14847_low_16
Description: NF14847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14847_low_16
NF14847_low_16
[»] chr7 (1 HSPs)
chr7 (18-214)||(43117687-43117875)


Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 43117875 - 43117687
Alignment:
Q  18 gttgcttagggcgtgcttcaggtcttcaattattctctgcaacatatatatgatacaacatgatatccacaagcttgacttcagaatacatgcagatgac 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||    
T  43117875 gttgcttagggcgtgcttcaggtcttcaattattctctgcaacatat----gatacaacatgatatccacaagcttgacttcagaatacatgcagatgac 43117780  T
Q  118 aatgaaactataacaatctctgatattggcataatattgtcggttgatgctaaagggtatgagggaataactaactcttctgccattttctgtgaaa 214  Q
    |||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |||    |||||||||||||||||| |||||||    
T  43117779 aatgaaactataacaatctctgatattggcataacaatgtcggttgatgctaaagggtatgagtgaa----taactcttctgccattttttgtgaaa 43117687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University