View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14844_low_11 (Length: 249)

Name: NF14844_low_11
Description: NF14844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14844_low_11
NF14844_low_11
[»] chr1 (1 HSPs)
chr1 (41-243)||(49589693-49589893)


Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 41 - 243
Target Start/End: Complemental strand, 49589893 - 49589693
Alignment:
Q  41 ttgtcacaaatggttatcaatatatcaatgctcttctcccaatattgagatcaaatttctattaacttataacacgtacaactaaaagaaaaataatact 140  Q
    ||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49589893 ttgtcacaaatagttatcaatatatcactactcttctcccaatattgagatcaaatttctattaacttataacacgtacaactaaaagaaaaataatact 49589794  T
Q  141 tttatagaaattgtaacatatatatactttcgcttttataccaccgagttcactttctcatcagtactcactaatttgatctcactttcactaatctcct 240  Q
    |||||||||||||||||   |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49589793 tttatagaaattgtaac--gtatatactttcgcttttataccactgagttcactttctcatcagtactcactaatttgatctcactttcactaatctcct 49589696  T
Q  241 atg 243  Q
    |||    
T  49589695 atg 49589693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University