View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1483_low_15 (Length: 208)

Name: NF1483_low_15
Description: NF1483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1483_low_15
NF1483_low_15
[»] chr2 (1 HSPs)
chr2 (19-174)||(32651419-32651574)


Alignment Details
Target: chr2 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 19 - 174
Target Start/End: Complemental strand, 32651574 - 32651419
Alignment:
Q  19 cgcttggcatctcttaccttaatctcagnnnnnnnatttggagtaaaccttaaacttcgtttgtgagcttagcttctcctaggtttaattattttttatc 118  Q
    |||||| |||||||||||||||||||||       || |||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||    
T  32651574 cgcttgtcatctcttaccttaatctcagtttttttatatggagtaaaccttaaacttcgtttgtaagcttagcttctcttaggtttaattattttttatc 32651475  T
Q  119 attgtttcaaccagctagcagtttacttacattattagtaactgcgccatttatct 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32651474 attgtttcaaccagctagcagtttacttacattattagtaactgcgccatttatct 32651419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University