View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14836_low_9 (Length: 417)

Name: NF14836_low_9
Description: NF14836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14836_low_9
NF14836_low_9
[»] chr5 (1 HSPs)
chr5 (36-403)||(2783297-2783659)


Alignment Details
Target: chr5 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 36 - 403
Target Start/End: Complemental strand, 2783659 - 2783297
Alignment:
Q  36 taaacatcaatggcgaagctattatccttagcttgctttcgaaacgaaggatggcacaatctttcagctagatctcactacccttccatgccttcttttc 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2783659 taaacatcaatggcgaagctattatccttagcttgctttcgaaacgaaggatggcacaatctttcagctagatctcactacccttccatgccttcttttc 2783560  T
Q  136 ccaaaagcgagccaggtacctccaccgtggaggagccgtccaaagtcaccgcacttttctcggtccatggtatgacttgctccgcttgcgctggatctgt 235  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2783559 ccaaaagcgagccaggtacctccaccgtggaggagccgtccaaagtcaccgcacttttctcggtccatggtatgacttgctccgcttgcgctggatctgt 2783460  T
Q  236 ggagaaatccatcaaacggctacatggaattcatgaagctgttgttgatgtacttcataaccgtgcccgcgtcatctttcacccctcttttgttaacgta 335  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2783459 ggagaaatccatcaaacggctacatggaattcatgaagctgttgttgatgtacttcataaccgtgcccgcgtcatctttcacccctcttttgttaacgta 2783360  T
Q  336 cgtaactcacccctcttttattcattttgtgtgatttactgagattcagtctttgtcgtttttcatct 403  Q
    ||||||||||||||||||||||||||||||||| ||||||||||     |||||||||||||||||||    
T  2783359 cgtaactcacccctcttttattcattttgtgtggtttactgaga-----tctttgtcgtttttcatct 2783297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University