View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14836_low_36 (Length: 229)

Name: NF14836_low_36
Description: NF14836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14836_low_36
NF14836_low_36
[»] chr2 (1 HSPs)
chr2 (163-201)||(10768267-10768305)
[»] chr4 (1 HSPs)
chr4 (20-57)||(33911803-33911840)


Alignment Details
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 163 - 201
Target Start/End: Complemental strand, 10768305 - 10768267
Alignment:
Q  163 tggttatgttagtttctagggttcgaaccctagacctcc 201  Q
    |||||||||||||||||||||||||||||||| ||||||    
T  10768305 tggttatgttagtttctagggttcgaaccctaaacctcc 10768267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 20 - 57
Target Start/End: Original strand, 33911803 - 33911840
Alignment:
Q  20 aaagtttacattgaaaagtgaatatgacattcattttg 57  Q
    ||||||| |||||||||||||| |||||||||||||||    
T  33911803 aaagtttgcattgaaaagtgaacatgacattcattttg 33911840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University