View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14834_low_8 (Length: 248)

Name: NF14834_low_8
Description: NF14834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14834_low_8
NF14834_low_8
[»] chr3 (1 HSPs)
chr3 (30-244)||(39501996-39502210)


Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 30 - 244
Target Start/End: Original strand, 39501996 - 39502210
Alignment:
Q  30 gaaaagtgactattgatgattgaggcagtgatgcaaatgcaaacgcataccctgtcgtcaaattcgcctcgaagactgtctcaagagaggaacttgatta 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  39501996 gaaaagtgactattgatgattgaggcagtgatgcaaatgcaaacgcataccctgtcgtcaaattcccctcgaagactgtctcaagagaggaacttgatta 39502095  T
Q  130 tcgaagaagagttggaggtacctgccatggctttttgttatcatctagcacaagtattatggttttaaactacggtcgctgaaattgcacttacatgtac 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39502096 tcgaagaagagttggaggtacctgccatggctttttgttatcatctaacacaagtattatggttttaaactacggtcgctgaaattgcacttacatgtac 39502195  T
Q  230 ttcaacatccttcat 244  Q
    |||||||||||||||    
T  39502196 ttcaacatccttcat 39502210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University