View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14833_high_30 (Length: 220)

Name: NF14833_high_30
Description: NF14833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14833_high_30
NF14833_high_30
[»] chr2 (2 HSPs)
chr2 (108-185)||(5680215-5680292)
chr2 (108-152)||(5689598-5689642)


Alignment Details
Target: chr2 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 108 - 185
Target Start/End: Complemental strand, 5680292 - 5680215
Alignment:
Q  108 cctgattattattggtgcatgacaccaatggaagaaggaggaggaggaggaagagacatgttgtggaaatgatgatgt 185  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  5680292 cctgattattattggtgcatgacaccaatggaagaaggagcaggaggaggaagagacatgttgtggaaatgatgatgt 5680215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 5689642 - 5689598
Alignment:
Q  108 cctgattattattggtgcatgacaccaatggaagaaggaggagga 152  Q
    |||||||||| ||||||||||| ||||||||||||||||| ||||    
T  5689642 cctgattatttttggtgcatgagaccaatggaagaaggagaagga 5689598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University