View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14832_high_9 (Length: 224)

Name: NF14832_high_9
Description: NF14832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14832_high_9
NF14832_high_9
[»] chr4 (1 HSPs)
chr4 (1-208)||(4487659-4487870)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 4487659 - 4487870
Alignment:
Q  1 ctcttctaattttgaaatttctatgttatatttttgtgttgtgattgaatccttttattttctctatgccgattttctccaacaccaccaacgttgccta 100  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||    
T  4487659 ctcttctaattttgaagtttctatgttatatttttgtgttgtgattgagtctttttattttctctatgccgattttctccaacaccaccaacgttgccta 4487758  T
Q  101 accccgcgttatacaggttgatggtgaggcacgcgggtagtgtgtgaagatacaaagctaggaagggagtggatat----gagggtggagccatgaggat 196  Q
    |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||    
T  4487759 accccgcgttatacaggttgatggcgaggcgcgcgggtagtgtgtgaagatacaaagctaggaagggagtggatatgaacgagggtggagccatgaggat 4487858  T
Q  197 gtggccattgtg 208  Q
    ||||||||||||    
T  4487859 gtggccattgtg 4487870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University