View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14825_low_14 (Length: 242)

Name: NF14825_low_14
Description: NF14825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14825_low_14
NF14825_low_14
[»] chr1 (1 HSPs)
chr1 (18-199)||(36562448-36562629)


Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 36562629 - 36562448
Alignment:
Q  18 atgaagaggctgtgatgcgtgggaagattcgtgaaatggaggaaaccattgaggttgctctggagaaggaaagggaaatgatggtggaaaatagtaaatt 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36562629 atgaagaggctgtgatgcgtgggaagattcgtgaaatggaggaaactattgaggttgctctggagaaggaaagggaaatgatggtggaaaatagtaaatt 36562530  T
Q  118 ggttggagagaagaaggagatggagaagagtattgagaatttgactgaggggagggatactgcttataggaccctggatatg 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  36562529 ggttggagagaagaaggagatggagaagagtattgagaatttgactgaggggagggatactgtttataggaccctggatatg 36562448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University