View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14823_high_9 (Length: 215)

Name: NF14823_high_9
Description: NF14823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14823_high_9
NF14823_high_9
[»] chr4 (1 HSPs)
chr4 (45-170)||(5113241-5113366)


Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 45 - 170
Target Start/End: Complemental strand, 5113366 - 5113241
Alignment:
Q  45 aatggaaaactatgcattgcacaaaaaggaagaaagataatatttattcttgccttcgtataggcaggaacttgtccgccaagataaatttgcggtaaaa 144  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5113366 aatggaaaactatgcattgcacgaaaaggaagaaagataatatttattcatgccttcgtataggcaggaacttgtccgccaagataaatttgcggtaaaa 5113267  T
Q  145 ctctgcatcaagctctttaattcttt 170  Q
    ||||||||||||||||||||||||||    
T  5113266 ctctgcatcaagctctttaattcttt 5113241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University