View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14823_high_10 (Length: 214)

Name: NF14823_high_10
Description: NF14823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14823_high_10
NF14823_high_10
[»] chr4 (1 HSPs)
chr4 (20-197)||(52133065-52133242)
[»] chr2 (1 HSPs)
chr2 (51-186)||(17953320-17953455)


Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 20 - 197
Target Start/End: Complemental strand, 52133242 - 52133065
Alignment:
Q  20 agtagcgatgaagttgatgagataatgggattatcattaactcttgatgattggatgagactggattcaggtgaaattgatgatatagatgatatcagtg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52133242 agtagcgatgaagttgatgagataatgggattatcattaactcttgatgattggatgagactggattcaggtgaaattgatgatatagatgatatcagtg 52133143  T
Q  120 agcatacttgcaaacttcttgctgcccatcatgccaactctttcgacgtaatccgtgagagttcaaagggaaggaaga 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52133142 agcatacttgcaaacttcttgctgcccatcatgccaactctttcgacgtaatccgtgagagttcaaagggaaggaaga 52133065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 51 - 186
Target Start/End: Original strand, 17953320 - 17953455
Alignment:
Q  51 tatcattaactcttgatgattggatgagactggattcaggtgaaattgatgatatagatgatatcagtgagcatacttgcaaacttcttgctgcccatca 150  Q
    |||| |||||||||||||| |||||||  |||||||| ||||| ||||||||| | ||| ||||||||||||||||||  ||||||||||| ||||||||    
T  17953320 tatcgttaactcttgatgagtggatgaagctggattctggtgacattgatgatgtcgataatatcagtgagcatacttcgaaacttcttgcagcccatca 17953419  T
Q  151 tgccaactctttcgacgtaatccgtgagagttcaaa 186  Q
    ||| |||||||||||| | ||||||| |||||||||    
T  17953420 tgctaactctttcgactttatccgtgggagttcaaa 17953455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University