View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14821_low_23 (Length: 218)

Name: NF14821_low_23
Description: NF14821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14821_low_23
NF14821_low_23
[»] chr3 (2 HSPs)
chr3 (18-84)||(53842696-53842762)
chr3 (150-201)||(53842579-53842630)


Alignment Details
Target: chr3 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 53842762 - 53842696
Alignment:
Q  18 atcaatgtatccatttactaaacggttttctgatattaattggcgtatccttgtgttgataattcct 84  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53842762 atcaatgtatccatttactaaacggttttctgatattaattggcgtatccttgtgttgataattcct 53842696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 150 - 201
Target Start/End: Complemental strand, 53842630 - 53842579
Alignment:
Q  150 ttctgttcataatcttctttccaaccttccttttatcaacactgctaattct 201  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  53842630 ttctgttcagaatcttctttccaaccttccttttatcaacactgctaattct 53842579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University