View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14819_low_47 (Length: 328)

Name: NF14819_low_47
Description: NF14819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14819_low_47
NF14819_low_47
[»] chr3 (2 HSPs)
chr3 (33-124)||(48350656-48350747)
chr3 (233-312)||(48350858-48350937)


Alignment Details
Target: chr3 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 33 - 124
Target Start/End: Original strand, 48350656 - 48350747
Alignment:
Q  33 ttgatatacatactcaaaggagtttgctaactatgcatatatgatttatttatttttactaaaactatgcataaatatgatatatactaaag 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48350656 ttgatatacatactcaaaggagtttgctaactatgcatatatgatttatttatttttactaaaactatgcataaatatgatatatactaaag 48350747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 233 - 312
Target Start/End: Original strand, 48350858 - 48350937
Alignment:
Q  233 ccgttatcataataaaaatggaaaataattacttataagtaacgtggatgtaatattaagtagaaaatacaattgaaaaa 312  Q
    ||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  48350858 ccgttatcataataaaaattgaaaataattacttataagtgacgtggatgtaatattaagtagaaaatacaattgaaaaa 48350937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University